Publication details
Způsob diagnostiky invazivní aspergilózy a oligonukleotidy pro použití při tomto způsobu
Title in English | Method of diagnosis of invasive aspergillosis and oligonucleotides for use in this way |
---|---|
Authors | |
Year of publication | 2011 |
Type | Patent |
MU Faculty or unit | |
Publisher | Úřad průmyslového vlastnictví |
State | Czech Republic |
Patent's number | 302670 |
Description | Method of diagnosis of invasive aspergillosis using DNA isolation and detection of Aspergillus fumigatus in biological samples taken from the patient resting in the fact that from a biological sample isolated DNA and then performs detection of gene ITS2 (internal transcribed spacer 2) for Aspergillus fumigatus ribosomal DNA by quantitative PCR with primers as for quantitative PCR used oligonucleotides having at least 85% nucleotide sequence identity with sequences GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO. 2) and CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO. 3), and is used as a probe TaqMan MGB probe, which has at least 85% nucleotide sequence identity with a sequence CCGACACCCAACTTT - MGB (SEQ ID NO. 4), the reduction of identity to 85% is achieved by extending or shortening the primers and / or probe. The subject of how the new oligonucleotides for use in the diagnosis of invasive aspergillosis. |